human akt2 sirna (forward primer: 5′–gcuccuucauuggguacaadtdt–3′; reverse primer: 5′–uaaugugcccguccuugucdtdt–3′)  (GenScript corporation)

Journal: Pharmaceutics

Article Title: ROS–Responsive Ferrocenyl Amphiphilic PAMAM Dendrimers for On–Demand Delivery of siRNA Therapeutics to Cancer Cells

doi: 10.3390/pharmaceutics16070936

Figure Lengend Snippet: Schematic presentation of ferrocenyl amphiphilic dendrimer-mediated siRNA delivery. ( A ) Chemical structure of the Fc-AmDs . ( B ) Cartoon illustration of Fc-AmD –mediated siRNA delivery.

Article Snippet: The human AKT2 siRNA (forward primer: 5′–GCUCCUUCAUUGGGUACAAdTdT–3′; reverse primer: 5′–UAAUGUGCCCGUCCUUGUCdTdT–3′) and GAPDH (forward primer: 5′–AATCCCATCACCATCTTCCA–3′; reverse primer: 5′–TGGACTCCACGACGTACTCA–3′) were purchased from GenScript Biotech Corp. (Nanjing, China).

Techniques:

Journal: Pharmaceutics

Article Title: ROS–Responsive Ferrocenyl Amphiphilic PAMAM Dendrimers for On–Demand Delivery of siRNA Therapeutics to Cancer Cells

doi: 10.3390/pharmaceutics16070936

Figure Lengend Snippet: ( A ) The CAC values of the Fc-AmDs were determined using fluorescent probe pyrene. ( B ) Gel retardation assay of siRNA with Fc-AmDs at N/P ratios ranging from 0.2 to 10 (200 ng siRNA per well). ( C ) AKT2 protein expression on SKOV–3 cells determined by Western blotting after treating with siAKT2/ Fc-AmDs complexes (50 nM siRNA, N/P ratio of 10). ( D ) siRNA release from the siRNA/ Fc-AmDs complexes was determined by heparin replacement assay (1.32 μg siRNA per well, N/P ratio of 10). *** p ≤ 0.001 (mean ± SD, n = 3).

Article Snippet: The human AKT2 siRNA (forward primer: 5′–GCUCCUUCAUUGGGUACAAdTdT–3′; reverse primer: 5′–UAAUGUGCCCGUCCUUGUCdTdT–3′) and GAPDH (forward primer: 5′–AATCCCATCACCATCTTCCA–3′; reverse primer: 5′–TGGACTCCACGACGTACTCA–3′) were purchased from GenScript Biotech Corp. (Nanjing, China).

Techniques: Electrophoretic Mobility Shift Assay, Expressing, Western Blot

Journal: Pharmaceutics

Article Title: ROS–Responsive Ferrocenyl Amphiphilic PAMAM Dendrimers for On–Demand Delivery of siRNA Therapeutics to Cancer Cells

doi: 10.3390/pharmaceutics16070936

Figure Lengend Snippet: ( A ) DLS analysis of the ROS–responsive disassembly of siRNA/ Fc-C 8 -AmD 8A nanoparticles (1.0 μM siRNA, N/P ratio of 10). ( B ) ROS–responsive siRNA delivery mediated by Fc-C 8 -AmD 8A in ROS–rich SKOV–3 cells and ROS–poor SKOV–3 cells (pretreated with antioxidant NAC) (50 nM siRNA, N/P ratio of 10). ( C ) mRNA and ( D ) protein expression of AKT2 determined by qRT–PCR and Western blot after treating with Fc-C 8 -AmD 8A with siAKT2 in comparison with control, siAKT2 alone, Fc-C 8 -AmD 8A alone, Fc-C 8 -AmD 8A with scrambled siRNA (50 nM siRNA, N/P ratio of 10). *** p ≤ 0.001 (mean ± SD, n = 3).

Article Snippet: The human AKT2 siRNA (forward primer: 5′–GCUCCUUCAUUGGGUACAAdTdT–3′; reverse primer: 5′–UAAUGUGCCCGUCCUUGUCdTdT–3′) and GAPDH (forward primer: 5′–AATCCCATCACCATCTTCCA–3′; reverse primer: 5′–TGGACTCCACGACGTACTCA–3′) were purchased from GenScript Biotech Corp. (Nanjing, China).

Techniques: Expressing, Quantitative RT-PCR, Western Blot, Comparison, Control

Journal: Pharmaceutics

Article Title: ROS–Responsive Ferrocenyl Amphiphilic PAMAM Dendrimers for On–Demand Delivery of siRNA Therapeutics to Cancer Cells

doi: 10.3390/pharmaceutics16070936

Figure Lengend Snippet: Fc-C 8 -AmD 8A –mediated siRNA delivery combines the beneficial properties of both lipid and dendrimer vectors. ( A ) Compared to Fc-C 8 -AmD 8A , neither the Fc alkyl chain entity Fc-C 8 -N 3 nor the dendron 8A led to any gene silencing with 50 nM siRNA at N/P ratio of 10. ( B ) Dioleoylphosphatidylethanolamine (DOPE) enhanced the gene silencing of AKT2 after treatment of siRNA/Fc-C 8 -AmD 8A complexes with 50 nM siRNA at N/P ratio of 10 on SKOV–3 cells. ( C ) The presence of bafilomycin A1 decreased the Fc-C 8 -AmD 8A –mediated gene silencing of AKT2 on SKOV–3 on cells (50 nM siRNA, N/P ratio of 10).

Article Snippet: The human AKT2 siRNA (forward primer: 5′–GCUCCUUCAUUGGGUACAAdTdT–3′; reverse primer: 5′–UAAUGUGCCCGUCCUUGUCdTdT–3′) and GAPDH (forward primer: 5′–AATCCCATCACCATCTTCCA–3′; reverse primer: 5′–TGGACTCCACGACGTACTCA–3′) were purchased from GenScript Biotech Corp. (Nanjing, China).

Techniques:

Journal: Journal of Cancer

Article Title: Preferential Effect of Akt2-Dependent Signaling on the Cellular Viability of Ovarian Cancer Cells in Response to EGF

doi: 10.7150/jca.9688

Figure Lengend Snippet: Akt2 signaling involves in EGF-activated cell viability. (A) Effects of EGF on Akt activation and status of Akt isoforms between OVCAR-3 and SKOV-3 ovarian cancer cells. Cells were treated with EGF (10 ng/mL) in a time-dependent manner (0, 5, 15, 30, 60 and 120 min). (B) Effect of siRNAs for Akt1 and Akt2 on EGF-activated Akt and Erk in OVCAR-3 cells. Cells were transiently transfected with siRNAs for Akt1 and Akt2 (final concentration 10 nmol/L) using the transfection reagent for 48 h followed by treatment with EGF (10 ng/mL) in a time-dependent manner (0, 5 and 15 min). (C) Effects of Akt1/2 siRNAs on EGF-induced cell viability in OVCAR-3 cells. Cells were transiently transfected with Akt1/2 siRNAs (final concentration 10 nmol/L) using the transfection reagent for 48 h followed by treatment for 48 h with EGF (10 ng/mL). (D) Effects of s Erk1/2 iRNAs on EGF-induced cell viability in OVCAR-3 cells. Cells were transiently transfected with Erk1/2 siRNAs (final concentration 10 nmol/L) for 48 h followed by treatment for 48 h with EGF (10 ng/mL). Blackened bars were EGF treated. * and ** indicate a significant increase (p≤0.05) between treatments by ANOVA and Tukey's pairwise comparisons. (E) The validation of Erk1 and Erk2 silencing. For western blot, whole cell lysates were prepared and immunoblots were carried out using antibodies specific for phosphorylated Akt (pAkt) and pErk, pan Akt and the three Akt isoforms (Akt1, Akt2 and Akt3). Pan Akt and β-actin were used as loading controls. Experiments were performed in duplicate and a representative result is shown. The cell viability assay was performed by using MTT, and values were normalized to untreated controls. Blackened bars were EGF treated. * and # indicate a significant increase and decrease (p≤0.05), respectively, by ANOVA and Tukey's pairwise comparisons. Experiments were performed in triplicate and all data are shown as mean ± SEM.

Article Snippet: Antibodies for MAPK/Akt isoforms and human-specific/mouse-specific Akt2 siRNAs were obtained from Cell Signaling Technology (Danvers, MA).

Techniques: Activation Assay, Transfection, Concentration Assay, Western Blot, Viability Assay

Journal: Journal of Cancer

Article Title: Preferential Effect of Akt2-Dependent Signaling on the Cellular Viability of Ovarian Cancer Cells in Response to EGF

doi: 10.7150/jca.9688

Figure Lengend Snippet: EGF markedly induces cell viability in Akt2-expressing ovarian cancer cells. (A) The expression pattern of Akt isoforms in mouse and five human ovarian cancer cells. The abbreviations of cells used were: ID8 (mouse epithelial ovarian cancer cells); OV (OVCAR-3); SK (SKOV-3); A (A2780); Ca (CaOV-3); and TOV (TOV-21G). MB231 cells are used as a positive control for Akt3. (B) Comparative effect of EGF on cell viability in SKA versus SKAKT2 cells. Cells were treated for 48 h with EGF (0, 5 or 10 ng/mL). Blackened bars were SKAKT2 cells and * indicates a significant increase (p≤0.05) relative to control by ANOVA and Tukey's pairwise comparisons. The validation of Akt2 expression was confirmed by western blot. (C) Comparison of cell viability in SKA versus SKAKT2 cells. Cells were cultured for 24, 48 and 72 h. Blackened bars were SKAKT2 cells and * indicates a significant increase (p≤0.05) relative to SKA cells by Student's t -test. (D) Effects of EGF on the Akt and Erk activation in SKA versus SKAKT2 cells. Cells were treated with EGF (10 ng/mL) in a time-dependent manner (0, 5, 15, 30, 60 and 120 min). For western blot, whole cell lysates were prepared and immunoblot was carried out using antibodies specific to phosphorylated Akt (pAkt) and Erk (pErk), Akt1/2/3 and Erk1/2. β-actin was used as a loading control. Experiments were performed in duplicate and a representative result is shown. (E) Effects of Akt2 siRNA on EGF-induced cell viability in ID8 cells. Cells were transiently transfected with Control or Akt2 siRNAs (final concentration 10 nmol/L) using the transfection reagent for 48 h followed by treatment for 48 h with EGF (10 ng/mL). The validation of Akt2 silencing was confirmed by western blot. The cell viability assay was performed by using MTT, and values were normalized to controls. Experiments were performed in triplicate and all data are shown as mean ± SEM.

Article Snippet: Antibodies for MAPK/Akt isoforms and human-specific/mouse-specific Akt2 siRNAs were obtained from Cell Signaling Technology (Danvers, MA).

Techniques: Expressing, Positive Control, Western Blot, Cell Culture, Activation Assay, Transfection, Concentration Assay, Viability Assay